General Genetics? - primer express software
A researcher wants to bring the gene for growth hormone in mammals in a bacterial cell expression. You will receive the gene from genomic DNA, as described below. You want some of these sequences for cloning (union) of a plasmid that can develop the gene expression in E. coli. Draw arrows, if you make 2 to enhance primer sequences that want to clone to. The arrows are oriented so that the 3 'end of the tip of the arrow as the 5 '3'. Why sequences (or why the sequences are left out)? What is on the plasmid of the gene must be translated correctly? What should the plasmid of the offer, if the goal is as much protein from mRNA (which is necessary to run for the translation of success)? If this is indeed a gene from genomic DNA of mammals, it must be the lack of expression of success?
Promoter (RNA polymerase II) --
1 comment:
Well, let me first say that this is certainly not a general question, genetics ... It is actually a higher level (ie, seniors and graduate students in the school) the question specifically designed for molecular biology and genetic basis.
Anyway, I do not see the picture of mammalian genes for growth factors, but not the gene segments called exons and introns mammals. The exons of mammals are the segments of the genes are linked on the plasmid and thus the transcription and translation.
As for the primer a segment of genes by PCR, one is forward and a reverse primer is required to strengthen these primers attach to the exons of the gene of mammals. Like the mammalian DNA double-stranded and additional support staff called) 5 'to 3' and the second chapter, also known as anti-template Volume 3 '5 '(where the DNA is twice as flexible. Thus, the 5 'end of the model is compared to the 3' end of the anti-template ... and the 3 'end of the strand complementary to the 5'-endanti template.
The first term is always the same sequence that starts the 5 'to 3' strand template. Thus, in the DNA strand of mammals in the exon, there is an arrow with the base of the arrow 5 'and the tip of the arrow 3'.
The first loss is ..... A bit more difficult in the anti-template chain, which currently (from right to left) 5 'to 3', an arrow in Chapter anti template from the 5 'end and pulled the arrowhead to the end 3'. The first page is a sequence, the anti-template added to the 5'-3 'end of the chapter.
For example go here:
------------------>> ........... .....................
5 'ATGGCGCAATATGTTTCAGTTTTA 3'
3 'TACCGCGTTATACAAAGTCAAAAT 5'
.......................... ............ \\ \\ \\ \\ \\ \\ \\ \\ U0026lt \\ \\ \\ \\ \\ \\ \\ \\ u0026lt ;-------------------
Forward primer: 5 'ATGGCGCAAT 3'
Revrese primner reverse primers: 3 'ATTTTGACTTT are 5' must be written always 5 'firstSo:
Only the exons must be collected ... and all exons of the mammalian cells for growth hormone should be elected under the same conditions as above. The sequences are ignored, no introns and transcribed and translated into proteins or growth hormones. Introns stay "in" the core, hence the term-Tron. Exons are from the core, having exported to the edges with special enzymes introns. The exons are transcribed and translated and exported from the nucleus. The exons of a gene are specifically made Togther to the correct form of protein ...
Successfully implemented for this gene must have a plasmid with an origin of replication, selection gene and) a multiple cloning sequence (MCS. Once exon binds the plasmid DNA to be replicated with a vector, then through an initiation transcribed bacterial promoter in an expression vector. For the translation of success, t-ribosomal RNA and a complex that is necessary ... They recognize the mRNA of human growth hormone and translated into proteins.
I am notI understand the last question. What we as an expression of lack of success? The gene or plasmid? I think that the gene ... and if so, lacking the gene introns are adequate for the expression. On this subject, I finally discussed.
I hope that what you need is .... Please, if you do not e-mail!
Post a Comment